Page 1 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, c)Funnel shaper part of oviduct that is closer to the, ovary, (3), 11. Explain different types of Intra uterine devices with, their example, (3), , HUMAN REPRODUCTION, AND, REPRODUCTIVE HEALTH, HSE-August 2021, 1. Expand the following terms, 2., 3., , 4., 5., 6., , 7., 8., , HSE-March 2021, (1), , a)MMR b)IMR, Identify the odd one, (1), (hPL, Androgen, Relaxin, hCG ), Disease or infections which are transmitted, through sexual intercourse are called sexually, transmitted disease (STDs), a)Give any two examples for STDs, b)Write any two preventive measures to avoid, STDs ?, (2), Identify the two types of cells lined on the inside of, seminiferous tubule. Distinguish their function (2), Mention two programmes implemented in India to, attain total reproductive health?, (2), How many spermatozoa and ova are produced, from 25 primary spermatocyte and 25 primary, oocytes ?, (2), Distinguish, between, spermiogenesis, and, spermiation ?, (2), Fill in the blanks with suitable terms given in, bracket, (Progestogen, Multiload-375, Vaults, Periodic, abstinence, Tubectomy, Saheli), (2), Barrier, Copper, Natural, Surgical, method, releasing, method, method, IUDs, Condom, (B), Coitus, (D), interrupts, (A), Cu-T, (C), Vasectomy, , 9. The wall of uterus has 3 layers of tissues, , by CDRI., (1), 13. During luteal phase of menstrual cycle, Graafian, follicle transforms into ____, (1), 14. Expand the following terms related with Assisted, Reproductive Technologies :, (2), (a) ICSI (b) GIFT, 15. Fill in the blanks to complete the schematic, representation, (2), , 16. Write any four objectives of Reproductive and, Child Health Care (RCH) programmes, (2), 17. Write, any, four, differences, between, Spermatogenesis and Oogenesis., (2), 18. In women, some hormones are secreted only, during pregnancy. Name any such hormones, (2), 19. Match the following, (2), , (2), , a)Name the three layers of uterine wall, b)Among these 3 layers, which layer is glandular, and undergo cyclic changes during menstrual cycle, ?, 10. Identify the pars of oviduct (fallopian tue) from, below description :, a)Finger like projection of oviduct that helps in, collection of the ovum after ovulation, b)The part of oviduct with narrow lumen that joins, the uterus, NAVAS CHEEMADAN, , 12. Name the oral contraceptive for female developed, , 20. Match the following, , 21. ‘LH, , and FSH, spermatogenesis.’, , (2), , play, , significant, , [email protected], , role, , in, (3)

Page 2 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, (a) Write the functions of LH and FSH in, spermatogenesis., (b) Write a single term used to denote LH and FSH, together., 22. Sexually Transmitted Diseases (STDs) are seen to, be high among people with age group 15 – 24 yrs., (a) Write the names of any 4 STDs., (b) Mention the measures to be taken to prevent, STDs., (3), , SOHSS-AREEKODE, , (a) Identify A and B., (b) Explain this surgical method., (c) Why this method is generally advised as a, terminal method of contraception ?, , HSE –March-2020, , HSE –July-2020, 23. The embryo with 8 to 16 blastomeres is called a, ________., (1), (a) Gastrula, (b) Morula, (c) Blastula, (d) Trophoblast, 24. Observe the diagrammatic view of male, reproductive system given below and name the, parts labeled ‘a’, ‘b’, ‘c’ and ‘d’., (2), , 28. Name the technique of transferring embryos up to, 8 blastomeres into the fallopian tube., (1), a)GIFT b)ZIFT c)ICSI d) IUI, 29. “All copulations lead to fertilization and, pregnancy”. Do you agree with this statement?, Justify your answer., (2), 30. Amniocentesis for sex determination is legally, banned now., (2), (a) What is amniocentesis ?, (b) Why it is banned ?, 31. The graph given below shows the level of the, ovarian hormones in a normally menstruating, woman during the follicular phase., (3), , 25. Rearrange the following human reproductive, events in the correct order of their occurrence (2), , 26. (a) Expand ART., , (2), (b) Suggest the ART which may be successful in the, following condition :, (i) Inability of the male partner to inseminate, the female., (ii) Female cannot produce ovum but can, provide suitable environment for, fertilisation and further development., , 27. Observe the diagrams A and B given below related, to contraceptive methods., NAVAS CHEEMADAN, , (3), , (a) Name ‘A’ and ‘B’., (b) Reconstruct the graph showing the level of, hormones in luteal phase., (c) Name the hormone secreted by Corpus Luteum, and mention its function., , HSE-June-2019, 32. Find out the correct sequence :, (a) Fertilisation- zygote, cleavage - Implantation, (b) Fertilisation- zygote, Implantation - Blastula, (c) Fertilisation- zygote, Implantation - Blastula, (d) Fertilisation- zygote, Blastula – Implantation, , (1), - Blastula - Morula -, , - cleavage - Morula - Morula - cleavage - cleavage - Morula -, , [email protected]

Page 3 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, 33. 'LH Surge' induces the rupture of Graffian follicle, (a) Which gland produces LH and in which day LH, Surge happens?, (b) Write the role of LH in males., (2), 34. There are several method of in vitro fertilisation to, assist couples who lack the ability of fertilisation., (a) Give the popular name of the programme, (b) Suggest two techniques of in vitro fertilisation, and their conditions of transfer to assist these, people, (3), , HSE-March-2019, 35. The milk produced during the initial few days of, lactation is called…………………., (1), 36. "The sex of the baby is determined by the father, and not by the mother. Do you agree with this, statement ? Substantiate your answer., (2), 37. Observe the diagram given below showing the, reproductive system of the female and name the, parts labeled 'A', sectional view 'B', C' &'D', (2), , 38. A wide range of contraceptive methods are, presently available. If so,, (HSE-March-2019)(2), (a) Name one contraceptive method having least, side effect., (b) Which contraceptive method is generally, advised for females as a termination method to, prevent any more pregnancies?, (c) List out any two possible ill-effects of the usage, of contraceptive methods., 39. (a) Expand STDs., (b) Cite any two examples for STD., (c) Suggest any two methods for the prevention of, STDs., (3), , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , a) 25 b)50 c)100 d)250, 41. Select the relationship between the first two, words and fill the lank space with a suitable, word, (1), Sterilization in male : Vasectomy, Sterilization in female :............., 42. The incidence of STDs are reported more, among the age group between 15-24 years., (2nci), (a) What are STDs?, (b) Suggest methods to prevent STDs,, 43. Match the column B &C with column A, (3), , HSE-March-2018, 44. Name the cells in testis which synthesize and, secrete androgens?, (1), 45. Different contraceptive methods are given, below. Pick out the odd one, (1), a)Cu T b)Saheli, c)Multiload 375 d)Lippes loop, 46. In a class room discussion, a student said that, sex of the baby is determined by the father., Analyse the statement and give reason for it ?, (2), 47. Different contraceptive methods are used to, control population explosion. Summarise the, natural method and barrier method of, contraception ?, (2), 48. Sexually transmitted disease (STD) are mainly, transmitted through sexual contact, (3), a)Name any two examples of STD?, b)Explain any two methods adopted to prevent, STD ?, , HSE-June-2018, 40. Number of spermatids produced from 25, primary spermatocytes are ..........., (1), NAVAS CHEEMADAN, , [email protected]

Page 4 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , HSE-March-2018-Model Exam, , HSE-March-2017, , 49. The middle layer of uterus is called………, (1), 50. Vasectomy and tubectomy are said to be, effective and irreversible contraceptive, methods. Differentiate between these two, methods., (2), 51. From an infertility clinic a doctor advised a, childless couple to undergo GIFT., l. Expand GIFT, 2. Mention the steps involved in this, procedure, (2), , 55. Which of the following pairs of STDs is, completely curable ?, (1), a)HIV, Hepatitis B, b)Hepatitis B, Gonorrhoea, c)Symphils, Gonorrhoea, d)Chlamydomonas, Genital Herpes, 56. Feeding...................in the first few days is, essential for preventing infection in a newly, born baby, (1), 57. LH and FSH are gonadotrophins. Distinguish, their roles in male and female?, (2), 58. What is ART ? Categorize the following ART’s, based on their application in male sterility and, female sterility:, GIFT, AI, , HSE-JUNE-2017, 52. Human female possess 44+XX chromosome, number. The chromosome number of, secondary oocyte is, (1), a)44+XX b)22+X c)44+XX d)22+XX, 53. Observe the diagram and answer the question, (2), , a) Identify A and B, b) Write the function of B, 54. Prepare a brief notes to be presented in an, awareness programme for adolescent about, AIDS, their causes and preventive measures?, (3), , NAVAS CHEEMADAN, , HSE-June-2016, 59. The process of fusion of sperm with ovum is, called........................., (1), 60. Match the column A and B, (2), , 61. Select the odd one and justify your selection?, Malaria, Gonorrhoea ,Amoebiasis, filariasis (1), 62. Diagnostic report of two couples having, infertility problem are given below :, (2), 1) The Women cannot produce ovum, 2) The man has very low sperm count in, semen., Suggest a suitable assisted reproductive, technology (ART) for each problem in, expanded form., HSE-March-2016, 63. Breast feeding during initial period of infant growth, is necessary to develop immunity of new born, babies. Why ?, (1), [email protected]

Page 5 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, 64. Categorise the given birth control methods into, three groups with proper heads., (Cervical caps, Vasectomy, Cu T, Tubectomy,, Diaphragms, Condoms, Lippes Loop ), (3), 65. match the columns A and B, (2), A, B, Corpus Luteum, Embryo, Leydig cells, Implantation, Blastocyst, Progesterone, Inner cell mass, Androgens, Prolactin, , HSE-June-2015, 66. Choose the odd one from the following and, write common features of others., (1), a)Estrogen b)Anrogen c)Relaxin, d)Progesterone, 67. Some techniques commonly used for, infertility treatment are given below. Read, them carefully and answer the question, ZIFT,GIFT,ICSI,IUI,IVF, (3), a)which of the above techniques is used, for the collection of sperm from the, husband or a healthy donor and artificially, introduced into the vagina or uterus of, the female?, b)Distinguish between ZIFT and GIFT, c)Write the common term used to denote, the techniques given below ?, 68. Complete, the, flow, chart, showing, spermatogenesis by filling A and B and answer, the question, (2), , a)what is the chromosome number of, primary spermatocyte?, b)what is the significance of reduction, division in spermatognenesis?, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , HSE-March-2015, 69. Foetal sex can e determined by a test based, on chromosomal pattern from the amniotic, fluid, (2), a)What is this test?, b)Revealing of sex determination through this, test is banned. Is this ban is necessary ?, c) invitro fertilisation followed by embryo, transfer is known as ......., 70. 1)In which part of human reproductive, system the following events occur?, (2), a)Fertilisation b)Implantation, 2)Diagram of a Human blastocyst is given, below .Identify A and B, , 71. It is evident that, it is the genetic makeup of, the sperm that determine the sex of the child, in human being. Substantiate., (2), 72. Identify the diagram and write how it acts (1), , 73. Mothers milk is considered essential for new, born infants, (1), a)Name the fluid secreted by mother from, breast during the initial days of lactation, b)What type of immunity it provides, 74. Schematic representation of Gametogenesis, is given below . Identify A. Write one, difference between A and B, (1), , NAVAS CHEEMADAN, , [email protected]

Page 6 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , HSE-June-2014, 75. ........... and, ..........are, two, surgical, contraceptive methods in male and female, respectively, (1), 76. Diagram of mammalian sperm is given below., Label the parts marked, (1), , 77. Sex of the bay is determined by the father,, not by the mother. Substantiate? (2), 78. Amniocentesis for sex determination is, banned in our country? Is this Ban necessary?, Comment one use of amniocentesis?, (2), HSE-MARCH-2014, 79. Observe the diagram and answer the question, (3), a) Identify A and B, b) What is the function of C, c) In which of the marked part reduction, division takes place? What is the significance, of it?, NAVAS CHEEMADAN, , 80. One of our neighbour is suffering from, itching, fluid discharge, slight pain and, swelling in the genital region, (2), a)What do you think the disease he is, suffering from?, b)What measures are to be taken to prevent, such disease, 81. Expand the following abbreviations which are, commonly used in reproductive health, a)ART, b)ZIFT, (1), HSE-SAY-2013, 82. Though one ovum is produced from a primary, oocyte it can result into a male or female, child after fertilisation. But in these case of, spermatocyte though 4 sperms are produced, only two of the can result to a female child, after fertilisation justify?, (1), 83. Sterilization and IUDs are effective birth, control, measures,, but, lactational, amenorrhoea may not be so effective, a)How the sterilization procedure of male, differ from that of female in preventing, pregnancy?, (2), b) Which part of the female reproductive, organ is utilized for the IUD procedure? How, this procedure prevents pregnancy?, (2), c)Why the lactational amenrrhoea is not so, effective?, (1), , [email protected]

Page 7 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , HSE-MARCH-2013, 84. The following statements compare the, process of Oogenesis and spermatogenesis., Which one is not true, a)Production of ovum ceases at certain age,, but sperm production continues even in old, men, b)Oogenesis begins in the embryonic stages,, but spermatogenesis starts at the oneset of, puberty., c)Meiotic arrest occurs both in Oogenesis and, spermatogenesis., d)Polar bodies are formed in Oogenesis, (1), 85. Suggest the ART which may be successful in, the following conditions, (3), a)A female cannot produce an ovum, but can, provide suitable environment for fertilization, and further development, b)Male partner is unable to inseminate the, female or has very poor sperm count, c)Fusion of gamete and zygote formation, doesnot occur within the body of female, 86. The diagram represents a process of, gametogenesis. Closely observe it and answer, the following, (2), a)Is it spermatogenesis or Oogenesis?, b)What does smaller shaded circle represent?, c)Write down two significance of production, of same?, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , HSE-SAY-2012, 87. Find out the odd one from the following,, write the reason, (1), a)Cu T, b)Cu 7 c)LNG-20 d)Multiload-375, 88. One couple came to know that they have a, girl child during fourth month of pregnancy, and they decided to do MTP, (2), a)What is MTP?, b)At which stage of pregnancy MTP relatively, safe?, c)How will you respond to the decision of, female foeticide by the couple?, 89. Observe the diagram provided (do not copy, the picture), (3), , a)Label A and B, b)On which day of menstrual cycle Graffian, follicle rupture?, c)Name the process induces the rupture of, graffian follicle, d)Write the name and function of the, structure forming inside the ovary after, rupture of Graffian follicle?, HSE-March-2012, 90. “STDs present a major health concern in both, industrialization and developing countries”, (3), a) What you meant by STD?, b) Name two STDs?, c) Suggest two preventive measures?, 91. Some stages of embryonic development are, given below. Observe these diagram and, answer the question, (3), , NAVAS CHEEMADAN, , [email protected]

Page 8 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , a)What is A and B?, b)Name the two types of cells found in the, Blastocyst?, c)Which layer of blastocyst is attached to the, endometrium? And Name the process?, HSE-SAY-2011, 92. Note the relationship between first two terms, and suggest a suitable terms for the fourth, place, (1), a)Progesteron, :, Corpus luteum, HCG, :, ........................, b)GIFT, :, Gamete, ZIFT, :, ........................, 93. Observe the Graph provided, , a)What do A and B stands for?, (1), 94. Nalini is four month pregnant at the, insistence of her mother in law, she, underwent an illegal diagnostic procedure by, which the sex of the baby was determined to, be female . Nalini’s mother in law cursed her, for conceiving a girl child., a)What is the diagnostic procedure used, here?, b) “scientifically, Nalini is not responsible for, conceiving a girl child”. How will you, substantiate this statement?, (1), 95. Observe the diagram provided and identify, the process:, (2), , NAVAS CHEEMADAN, , a)Label; A,B,C and D, b)Why the gametes produced are haploid, even though the gamete mother cells are, diploid?, 96. Raju has lost his mother at birth. He is, unhealthy and contract diseases easily. In his, Doctor’s opinion, Raju’s ill health is due to his, not drinking mother’s milk., How will you justify the doctor’s opinion in, the light of your knowledge of immunity? (2), HSE-MARCH-2011, 97. One among the contraceptive method is, peculiar. Find the odd one and what is the, common among others?, (1), a)Periodic abstinence, b)coitus interruptus, c)Lactational amenorrhea, d)IUDs, 98. The treatment facility advertised on the, brochure of a private clinic is shown below, a)Can you suggest what type of clinic is?, b)Make a brief note on any three of the, treatment procedure?, (2), , IVF, , ZIFT, , GIFT, , [email protected], , IUI

Page 9 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , the diagram and answer the following, questions., (2), , 99., The above graph shows the level of ovarian, hormones in a normally menstruating women, during follicular phase, (3), a)Name A and B, b)Mention the role of pituitary hormones in, maintaining this condition, c)Reconstruct the graph for luteal phase?, HSE-SAY-2010, 100. Select the ART that uses an early embryo, with upto 8 blastomeres, (1), a)ZIFT )IUT c)GIFT d)IUI, 101. The total population in India is alarmingly, increased to 1 billion according to 2001, censes. The population growth rate was still, around 1.7%, a rate at which our population, could be double in 33 years, Cite the probable reasons for such an, increase in population growth rate?, (2), 102. The graph shown below shows the levels, of LH and FSH at various stages of menstrual, cycle., (3), , a)Identify A and B, b)Write the function of A and B, 104. When the urine sample of a lady is tested,, presence of Human chorionic gonadotropin, (HCG) was detected, (2), a)What does the presence of HCG indicate?, b)Which is the source of HCG?, 105. Diagram shown below is a surgical, method used for female sterilization, (2), a) What is the method shown in the diagram?, b) Mention any two IUDs to prevent, conception?, c)what is surgical method of male sterilization, called?, , Click here to watch video lesson, , a)Name the source of LH and FSH, b)The level of LH is maximum during the, middle day of cycle. Mention its effect?, c)Note the function of LH in male?, HSE-March-2010, 103. Given below is the diagrammatic, representation of Human blastocyst. Observe, NAVAS CHEEMADAN, , [email protected]

Page 10 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, a)It is an autosome linked dominant disease, b)The heterozygous female (carrier), haemophilia may transmit the disease to son, Select the wrong statement and correct it, , PRINCIPLES OF INHERITANCE, AND VARIATION, HSE- August 2021, 1. Identify the symbol used in pedigree analysis, , for, , 10. A monohybrid cross is given below :, (1), , 2. T.H Morgan selected Drosophila melanogaster as, a suitable experimental organism. Mention any, two reason for selecting Drosophila as, experimental organism, (2), 3. Consider the two statements regarding the, haemophilia disorder, (2), (i) It is an autosome linked dominant disease., (ii) The heterozygous female (carrier) for, haemophilia may transmit the disease to son., Select the wrong statement and correct it., , HSE-March 2021, , Find the F2 phenotype and genotype ratio, , (2), , 11. Distinguish male heterogamety and female, heterogamety with example, , (3), , HSE-July-2020, 12. Select a female heterogametic animal from the, following :, (1), (a) Human beings (b) Drosophila, (c) Birds, (d) Grasshopper, 13. Complete the table using appropriate terms : (2), , 4. Name the genetic disorder in which a blood, clotting protein is affected leading to non-stop, bleeding even through a simple wound., (1), 5. Presence of an additional copy of chromosome 21, was observed in a person during diagnosis., (2), (a) Identify the genetic disorder, (b) Write the characteristic features of this, disorder, 6. If a father is with ‘O’ blood group and mother is, with ‘B’ blood group, write the possible blood, groups of their children., (2), 7. Micrograph of Red blood cells of two persons, (A) and (B) are shown below. Person B is affected, with a specific genetic disorder., (i) Identify the genetic disorder., (ii) Write reason for this disorder., , 14., , In a cross between a true breeding red flowered, and a true breeding white flowered plants, the F1, generation was pink coloured flowers. From this, cross –, (2), (a) Identify the Inheritance., (b) Give an example for this type of Inheritance., (c) Write the F2 phenotypic and genotypic ratio., , HSE-March-2020, 15. From the following, find out the symbol used in, the human pedigree analysis representing male., (1), , 16. Observe the figure given below showing Mendel’s, 8. ‘Incomplete Dominance’ is an example for, , experiment using pea plants., , deviation from Mendelian Inheritance. Illustrate, with example, (3), 9. Consider the two statement regarding the, haemophila disorder, NAVAS CHEEMADAN, , [email protected], , (2)

Page 11 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, Down's, syndrome,, Turner's, syndrome,, phenylketonuria, Klinefelter’s syndrome, (2), 22. The amino acid composition of the relevant, portion of β chain of two haemoglobin molecule, molecules (A & B) are shown below, (3), , (a) Identify the cross, (b) Which are the laws proposed by Mendel based on, this observations ?, (2), 17. Correct the following statements, if there is any, mistake :, (a) Haemophilia is a autosome linked recessive, disease., (b) Turner’s syndrome is due to the presence of an, additional copy of X chromosome, , HSE-June-2019, , (a)Which one of the polypeptide chain is, abnormal?, (b) Name the disorder caused by it., (c) What is the reason for this abnormality?, (d) What is the effect of this abnormality in such, individuals?, , HSE-June-2018, 23. Observe, , the, following, cross, between, heterozygous dominant progeny and homozygous, recessive parent. Answer the following questions, (2), , 18. Identify the following symbols in pedigree Analysis, , (1), 19. Observe the cross of a pure violet and white, flower, , (2), , a) Identify the cross?, b) Mention the significance of this cross?, 24. The following diagram shows amino acid, sequences of a part of β chain of haemoglobin of, 2 individuals. Observe the amino acid sequence, and answer the following questions :, (2), a) By using the F, progeny design a test cross., b) Mention the significance of test cross, 20. Each symptom of two chromosomal disorders are, given below :, (2), • Gynaecomastia, • Rudimentary ovary and lack of secondary, sexual characters, (a) Identify the disorders., (b) Give the reason for these disorders, , HSE-March-2019, 21. Find the odd one out. Justify your answer., NAVAS CHEEMADAN, , a) Which among the above indicate sickle cell, anemic condition?, b) Justify your answer?, c) Describe what is single base substitution?, [email protected]

Page 12 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, 25. The blood group of a child is 'O'. His father is with, 'A' blood group and mother with ‘B' blood group., Write, down the genotype of the child and, genotypes of parents., (2), , HSE-March-2018, 26. ln a classroom discussion, a student said that the, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, F1 Progenies are homozygous or heterozygous?, (2), 30. From a clinical laboratory, Ramu's blood group, was identified as 'AB' goup. But his father has 'A', blood group and mother has is 'B’ blood group., a) Is Ramu's blood group identification correct?, b) Substantiate your answer using co dominance, principle., (2), 31. Identify the syndromes ’A' and 'B', (2), , sex of the baby is determined by father. Analyze, the statement and give reason for it ?, (2), , 27., , HSE-JUNE-2017, 32. Observe the diagrammatic representation of, following pedigree analysis and answer the, question., (3), , a) Observe the above cross and name this, phenomenon?, b) Write down the theoretically given, explanation of the phenomenon, (2), 28. Haemophilia, Sickle cell anaemia and Phenyl, Ketonurea are Mendelian disorders, (a)What do you mean by mendelian disorder, (b) which one of the above is an example of in, born error of metabolism? Mention the cause, of disorder?, (2), HSE-Model Exam -2018, 29. Construct, , a monohybrid cross between, homozygous violet and white coloured flowers of, a pea plant How can one determine whether the, , NAVAS CHEEMADAN, , a) Describe the type of inheritance shown in the, diagram, b) Distinguish between Mendelian disorder and, chromosomal disorder with example?, , 33. Observe the following diagram and answer the, question, (Hint: step in making a cross in pea plant ), , [email protected], , (2)

Page 13 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , a) Name the process marked as A and writes its, significance?, b) Diagrammatically represent a monohybrid, cross between Tall and dwarf pea plant, , HSE-MARCH-2017, 34. The following table shows the F2 generation, of a Dihybrid cross. Identify the phenotype, with homozygous recessive genotype. Find, out A:B:C:D, (2), , a)Identify the figure?, b)what show the shaded symbols used?, , 38. a)Complete the flow chart of chromosomal, disorder by filling the blank boxes (A and B), (3), , 35. Which of the following do not have similar sex, chromosome? (homogametic ), , (1), , (1) Human female, (2) Drosophila female, (3) Bird female, (4) Bird male, 36. Examine the following fragment of beta globin, chain in human haemoglobin and identify the, hereditary disease with reason, (2), , b)What is aneuploidy ?, , HSE-March-2016, 39. Which of the following is not, , a, , disorder, Colourblindness, Down's syndrome,, Haemophilia, Thalassemia, , 40. Study the following cross and answer the, questions., [Hint: ABO blood group in man is controlled, by three alleles IA, IB and i.], , HSE-June-2016, 37. Observe the figure below and answer the, question following :, (2), , NAVAS CHEEMADAN, , Mendelian, (1), , [email protected]

Page 14 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, 43. Observe the inheritance shown in A and B, , a)Write the genotypes of Father, Mother and, Son., b)The type of dominance of human blood, group inheritance is…………………, (2), , a)Name the type of inheritance shown in A, and B?, b)What is the difference between the two, types of inheritance?, (2), , 41. Observe the figure and answer the question, (2), HSE-March-2015, , 44., , a) Identify the syndromes A and B.?, b) What is the chromosome numbers in A and, B?, , HSE-SAY-2015, 42. Diagrammatic representation of the pedigree, analysis of the inheritance of sickle cell, anaemia is shown below., (3), , a)Name the type of inheritance shown in the, figure ?, b) Write the genotype of A and B?, (Hint : Disease is controlled by a pair of allele, HbA and Hbs ), c)Represent pedigree analysis of an X linked, Recessive Inheritance diagrammatically, NAVAS CHEEMADAN, , a)Identify the syndrome from the diagram, and, write the genotype?, b)It occurs in both sexes (Male and female)? Write, the reason, (2), 45. Fill in the blanks:, (1), a)...............is a metabolic disorder that occurs due, to the lack of an enzyme that converts phenyl, alanine to tyrosine., b)...............is a disease caused by the substitution, of glutamic acid by valine at the 6th position, , 46. It is evident that, it is the genetic make of a sperm, that determine the sex of the child in human, beings. Substantiate, (2), HSE-SAY-2014, , [email protected]

Page 15 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, 47. Correct the amino acid sequence of sickle cell, hamemoglobin, (1), , 48. Identify they syndrome from the genotype given, below:, (1), a)44 Autosome + XXY, b) 44 Autosome +XO, 49. Sex of the Baby is determined by the father, not, by the mother. Substantiate, (2), 50. a)Define mutation, (1), b)What are the different types of mutation? (1), 51. The family of Queen Victoria shows a number of, Haemophilic descendants as she was the carrier of, the disease. Name the pattern of inheritance of, this Royal disease., (1), 52. a)Paternity or maternity can be determined by, certain scientific methods. What is it? Define, b)Briefly write the methodology involved in the, technique ?, c)comment on its other application, (3), HSE-March-2014, , 53. Explain the phenomenon shown in the following, figure and the reason for difference in the, production of recombinant in Cross A and cross B, as explained by Morgan., (3), , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, B)22 pairs of Autosome +XO, C)22 pairs of Autosome+ 1 autosome, D)22 pairs of Autosome+ XXY, a) Identify the person with who suffers from, Klinfelter’s syndrome. Write its symptoms, b)Differentiate, between, aneuploidy, and, polyploidy ?, (3), 55. Gopalan argues that if the father is of ‘A’ blood, group, Mother is of ‘B’ blood group. Their children, can be only be ‘A’ group, ‘B’ group or ‘AB’ group., a) Do you agree with Gopalan’s arguement?, b) Give reason for your argument?, (2), HSE-SAY-2013, , 56. In the given pedigree the shaded figure denotes, individuals expressing a specific trait, , (2), , Which of the following is the most probable mode, of inheritance of this trait, A-Simple mendalian recessive inheritance, B-Co dominant Relationship of a single pair of, allele, C-X linked recessive transmission, D-X linked dominant transmission, E-Polygenic inheritance, HSE-March-2013, , 57. Identify the trait from pedigree chart. Give one, example each., , (2), , 58. A poultry farm manager was cursing his hens for, , 54. Difference in chromosome number of some, human being A,B,C, and D is given below:, A)22 pairs of Autosome, NAVAS CHEEMADAN, , producing lion share of cocks in its progeny., Hearing this, Kumar-farm manager starts to lame, his wife for delivering consecutive girl children., Analyse the situation scientifically and state, whether you agree with kumar?, (3), HSE-SAY-2012, , 59. Diagrammatic representation of chromosome, map of Drosophila is given below, [email protected], , (2)

Page 16 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, HSE-say-2011, , 64. Symbols used in human pedigree analysis and, YYellow, WWhite, MMiniature, a)Which genes are more linked?, b)Who mapped chromosome firstly?, c)Tightly linked genes show low, recombination. Why?, 60. Work of a student is given below:, , their meanings are provided in the table. Fill in the, blanks with suitable meaning or symbols (1), , (3), , 65. Certain facts related to human disorder are given:, , a) From the above give an example for genotype, and phenotype?, b) Complete the work using the punnet square, and find out the phenotypic ratio in the F2, generation?, , 1)It is inborn error in metabolism, 2)It is inherited as an autosomal recessive trait, 3)The affected person is mentally retarded, a)name the disorder, b)What are the physiological processes behind, this mental retardation, (2), 66. A genetic cross is represented below, (2), , HSE-March-2012, , 61. Complete the tale using suitable term, Turner’s syndrome ..........a........, ---------b-------44A+XXY, --------d--------Trisomy-21, , (2), , Sterile female, ..........c........., Mental, retardation, 62. In Pea plant the gene for yellow seed colour is, dominant over green and round seed shape is, dominant over wrinkled. Write the four types of, gametes formed in heterozygous pea plant with, Yellow and round seeds (YyRr), (1), 63. The first child of a couple is affected with, Phenyketonuria. During the second pregnancy, they visited a genetic counsellor and Prepared a, pedigree chart of their family., (2), a)What is pedigree analysis?, b)Draw the symbols for, i) Affected female, ii) Sex unspecified, iii)Consanguineous mating, , NAVAS CHEEMADAN, , a) Identify the given cross?, b) Elaborate upon the significance of such cross?, HSE-March-2011, , 67. The frequency of occurring Royal disease or, Haemophilia is high in the pedigree of Royal, families of Queen Victoria. Which of the following, cannot be generally inferred from this?, (1), a)Queen Victoria was not homozygous for the, disease, b)Many heterozygous families were there in the, Royal family, c)Non-Royal families were not affected with, haemophilia, d)There is less possibility to become a female, diseased, e)Generally a diseased female cannot survive, after the first menstruation, f)Pedigree analysis is the study of inheritance, patterns of traits in human female., [email protected]

Page 17 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, 68. After analyzing the karyotype of a short statured, Round headed person with mental retardation, a, general physician noticed an addition of, autosomal chromosome ., Answer the following question, (2), a)Addition or deletion of chromosome generally, result in............., b)What may be the possible syndrome or disorder, of the above person should suspected to be?, c)Suggest two or more morphological peculiarity, to confirm the chromosome disorder in that, person?, 69. A couple has 2 daughters. The blood group of, husband and wife is O, (2), a)What is possible blood groups of the children, should have?, b)Whether any change in blood group will occur if, they have two sons instead of daughters?, HSE-SAY-2010, , 70. Some genetic abnormalities, their genotype and, features are distributed in Column A,B and C, respectively . Match them correctly, (1.5 mark), Column A, Column B, Column B, Down’s, 44A+XO, Rudimentary, syndrome, ovary and, sterility, Turner’s, 44A+XXY, Furrowed, syndrome, tongue, and, partially opened, mouth, Klinfelter’s, 45A+XX/XY, Gynaecomastia, syndrome, and sterility, , 71. The flow chart A and B given below represents the, inheritance of normal haemoglobin and sickle cell, haemoglobin, (3.5), , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, HSE-March-2010, , 72. To find out the unknown genotype of a violet, flowered pea plant a researcher done the, flowering cross. Observe the diagram and answer, the following question:, (Hint :Violet flower colour in pea plant is, dominant over white ), , a)What would be the above cross called?, b)can you determine the unknown genotype of, violet flowered parent by drawing Punnet square?, 73. Polypeptide chains of two haemoglobin molecules, are shown below. One of the chains shows an, abnormality. Observe the diagram and answer the, following questions, , a) Which of the polypeptide chain in the, haemoglobin is abnormal leading to a disease?, b)What is the reason for this abnormality ?, c)What will be the effect of this change in, polypeptide chain ?, , Click here to watch video lesson, , a) Observe the Flow chart A and complete the, flow chart B, b) Note down the genotype of a sickle cell, anaemia patient and mention the symptom of, the disease, c) Mention the peculiarity of HbAHBs phenotype, NAVAS CHEEMADAN, , [email protected]

Page 18 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , MOLECULAR BASIS OF INHERITANCE, HSE-August 2021, 1. Fill in the Blanks, , (1), , YAC: Yeast artificial chromosome, BAC :……………………………………., 2. Observe the diagram of lac operon, , (2), , a)Write the name of enzymes labeled as A,B and C, b)Which act as the inducer in Lac operon, 3. Observe the diagram below, , 8. The diagram represent DNA Replication process, , a)Re draw the diagram, rectifying if any mistakes, b)Name the two enzymes involved in DNA, Replication process, (3), , HSE-July-2020, 9. (a) Complete the flow chart given below showing, DNA finger-printing technique., , (2), , a) Identify the type of RNA Molecule, b) Write the base sequence complementary to, the anticodon loop ?, (2), , HSE-March 2021, 4. Under microscope, chromatin is seen as ‘beadson-string’ like structure. Here, ‘beads’ represent, the structures called _____., (1), 5. ‘In a cell, euchromatin and Heterochromatin can, be observed under microscope.’ Distinguish, between euchromatin and Heterochromatin. (2), 6. In eukaryotes, gene expression can be regulated, at several levels. Write different levels at which, gene expression can be regulated., (2), 7. Figure of ‘lac operon’ in the absence of lactose, (inducer) is given below. Draw the diagram of ‘lac, operon’ in the presence of lactose and label it. (3), NAVAS CHEEMADAN, , (b) Who developed the DNA finger-printing, technique ?, (c) Write the full form of VNTR., 10. Schematic structure of a transcription unit is given, below :, (2), , [email protected]

Page 19 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, (a) Identify a, b and c., (b) The coding sequences/expressed sequences in, eukaryotes are known as ________., , 11. Lactose catabolism in the absence of inducer in E., Coli is given below, , (3), , (a) Identify ‘P’., (b) Draw the diagram in the presence of inducer., (c) Write the enzymes produced by the structural, genes ‘z’, ‘y’ and ‘a’., , SOHSS-AREEKODE, (c) What would happen if both the strands of the, DNA act as templates for transcription?, , HSE-June-2019, 15. In a double stranded DNA, the ratios, , between Adenine and Thymine,, Guanine and Cytosine are constant and, equal one. Who observed this fact ? (1), 16. Observe the diagram of a double, stranded DNA strand :, (2), , HSE-March-2020, 12. One of the salient features of genetic code is, “Universal”., (2), (a) Write any other two salient features of Genetic, code, b) Which is the initiator codon ? And name the, amino acid it codes., 13. Observe the figure given below :, (3), , (a) Identify the process in the picture., (b) Name any two enzymes needed for this, process., (c) Write the peculiarities of the newly, synthesized daughter strands, 14. A DNA sequence is provided below. 5' –, ATGCATGCATGCATGCATGCATGCAT – 3', (3), (a) Write down the sequence of its, complementary strand., (b) Name the enzyme involved in transcription of, DNA., NAVAS CHEEMADAN, , Identify the bonds A, B, C & D., 17. The following diagram shows a process, , in the Ribosome :, , (2), , Identify the Process and explain, 18. Transcription of eukaryotes is more, , complicated than that of prokaryotes., Explain any two additional complexities, found in the transcription of, eukaryotes., (3), , [email protected]

Page 20 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , HSE March 2019, 19. Diagrammatic representation of the, central dogma given below is not, correct. make necessary corrections, and redraw it, (1), , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , (c) Who developed this technique first?, 22. The diagrammatic representation of a, process in bacteria is given below (3), , 20. Observe the figure given below :, , a) Identify the figure., b)How many histone molecules are, present in the Histone core ?, c)Distinguish between Euchromatin, and Heterochromatin., (2), 21. The diagrammatic representation of, the DNA fingerprint from a crime scene, and that of a suspected persons are, give below, (3), , a)What is your conclusion about the, suspects based on DNA Fingerprint, given ?, (b) What is VNTR ?, NAVAS CHEEMADAN, , a) Identify the process., b) Name the enzyme involved in this, process., c) Explain the three major steps in this, process., HSE JUNE 2018, 23. “Human genome project is a mega, , project” give two reason to explain, this?, (2), 24. Observe the diagram and answer the, following, (2), , a)Identify the diagram ?, b)Name the enzymes A,B, and C, 25. “Genetic code is universal in nature”, [email protected]

Page 21 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , a)Substantiate this statement ?, b)mention any two other salient, features of genetic code, (2), 26. Expand the following, (3), a)SNP b)BAC c)YAC, HSE MARCH 2018, 27. Expresses sequence in the gene is, , called, (1), a)Introns, b)Muton, c)Exons, d)Cistron, 28. DNA is tightly packed structure and is, found as units called nucleosomes, (a) Explain the concept of nucleosomes, (b)Differentiate between euchromatin, and hetero chromatin, (2), 29. Identify the disadvantages of RNA over, DNA as a genetic material and explain, it ?, (2), 30. a) In Lac-operon lactose act as inducer, molecule. Evaluate the statement and, explain it, (3), b) Observe the diagram of Lac –Operon, and Identify Labelled part A,B,C and, , c)Mention, two, fingerprinting., , uses, , of, , 32. Read the following statements and, , answer the following questions, 1-A genetic material should be able to, generate its replica, 2-A genetic material should not provide, scope for mutation, 3- A genetic material should be able to, express itself in the form of mendelian, characters., a. Choose the correct statements from, the above. b. Rewrite the wrong, statement to correct one, (2), 33. Observe the given diagram and answer, the following questions., (2), , HSE-Model-2018, 31. Complete the flow chart of Southern, , blot hybridization, , NAVAS CHEEMADAN, , DNA, , (2), , [email protected]

Page 22 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , a)Identify the above process., b) Name the enzyme required to, polymerise the DNAstrand., c) Name the enzyme required to join the, discontinuous strands, d) In eukaryotes replication of DNA occurs, at ……………phase of cell cycle., 34., , a) Name 'A' and ‘B' from the above, diagram., b. Describe the following terms, i) Capping ii)Tailing, HSE-JUNE-2017, 35. Find the odd one and write the, common feature of the other, (1), Cytidine, adenine, Thymine, guanine, 36. Observe the diagram, (2), , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , a)What will happend if the nitrogen, base ‘U’ in the 6th position is replaced, by ‘A’ by point mutation, b)Name and define this type of, mutation, c)draw the base sequence in the coding, DNA strand from which the above, mRNA is transcribed ?, HSE-March 2017, 38. Which of the following combinations, do not apply to DNA ?, ( 1), , 39. Examine the diagram of Mrna given, , below . Mark the 5’ end 3’ end of Mrna, by giving reason, (2), , 40. A small fragment of a skin of different, , a)Redraw the diagram correctly if any, mistake is there ?, b)what does the diagram indicate?, b)What is the function of DNAL ligase in, this process ?, 37. Read the codon sequence in the mRNA, unit which is undergone translation, (3), NAVAS CHEEMADAN, , person was extracted from nails of a, murdered person. This fragment of skin, led the crime investigators to the, murder. Ased on this incident answer, the following questions, (3), (1) What technique was used by the, investigators, (2) What is the procedure involved, in this technique, Or, 41. In an E.coli cultre lactose is used as, food instead of glucose. If So, answer, the following questions, (3), , [email protected]

Page 23 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , (1) How do the bacteria respond to, the above situation at genetic, level?, (2) If lactose is removed from the, medium what will happen?, HSE-June 2016, 42. Observe the figure of mRNA and, answer the following question, (3), , a)Find the start codon and stop, codon?, b)How many amino acids will be, present in the protein translated, from this Mrna ?, c)The additional sequences that are, not translated in the mRNA is, called......, 43. a) The hints of lac Operon is given, below (HSE-June-2016), (3), , a)which substance is acting as, inducer in this operon ?, b)explain the working of operon in, the presence of inducer ?, OR, 44. b)With the help of the figure given,, explain the processing of hnRNA mRNA, in eukaryotes, (3), , NAVAS CHEEMADAN, , HSE-March 2016, 45. Results of a famous experiment is given, in the figure .Answer all, (2), a)Identify the experiment ?, b)which property of DNA is proved, by experiment ?, , 46. Read carefully the sequence of codon, , in the mRNA unit and answer the, question, (2), , [email protected]

Page 24 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , a)what changes is needed in the, first codon to start the translation, process ?, b)if translation starts by that, change, till which codon it can be, continues ?, 47. Schematic representation of DNA, finger prints as shown below, , a)which one of the suspected, individual may involve in the crime ?, b)write any other use of DNA figure, print ?, (2), HSE-June -2015, 48. Observe the following diagram and, answer the question?, (3), , a) Diagrammatically represent changes, takes place when lactose is added to, medium?, b) What is the role of z,y, and a gene in, this metabolic pathway ?, 49. Observe the diagram and answer the, question?, (3), , a)what is the difference in the, replication process ins strand A and, strand B ?, b)what is the role of DNA ligase in, the replication process in B strand ?, c)what is meant by replication fork ?, HSE-March-2015, 50. Explain Transcription. A transcription, unit in a DNA is defined by 3 regions., Write the name of any 2 regions? (2), 51. a) The steps in DNA Finger printing are, given below. Complete the flow chart, (A and B), b)Mention the application of DNA, finger printing, (3), , 52. The flow of genetic information is, , shown below. Name the process of A, and B (1), , HSE-June-2014, 53. Diagrams of components of DNA are, , given below:, NAVAS CHEEMADAN, , [email protected], , (1)

Page 25 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , Identify and differentiate the two, diagrams I and II, , SOHSS-AREEKODE, , 58. Diagrammatic, , representation, of, ‘Central Dogma’ is given below :, Observe the diagram carefully and, redraw, it, making, appropriate, corrections, (1), , 54. a)Identify the diagram and explain, 59. Observe the diagram and answer the, , b)In some cases DNA is produced from, RNA. Name this process and give, example ?, (2), 55. a)Paternity and maternity can be, determined by certain scientific, methods. What is it? Define?, b)Briefly write the methodology, involved in the technique ?, c)Comment on its other application?, (3), 56. a)Define mutation ?, b)What are the different types of, mutation ?, (2), HSE-March-2014, 57. “Prediction of the sequence of, aminoacids from the nucleotide, sequence in mRNA is very easy, but the, exact, prediction, of, nucleotide, sequence in mRNA from the sequence, of amino acids coded by mRNA is, difficult”, a)Which property of genetic code is the, reason for the above condition ?, Explain, b)Which are the stop codons in DNA, transcription ?, (3), , NAVAS CHEEMADAN, , question, (2), a)Identify the process shown in the, figure and define it ?, b)Identify the structure ‘B’, write any, one function of it in the process shown, in the diagram ?, , HSE-Sept-2013, 60. Presence, , of lactose enhances the, production of beta galactosidase and, other enzymes in bacteria . How will, you explain this phenomenon ?, (1), 61. A DNA sequence for coding a peptide is, given below, , [email protected]

Page 26 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , a)Write the complementary mRNA coding, sequence for it ?, , 65. RNA is not an ideal molecule as genetic, , material because, , (1), , b)Find out the amino acids sequence of, peptide chain using the codon given in the, hints, c)if a mutation causes a change in the, sixth codon CTC to CAC. It leads to a, mendelian disorder. Identify the disease, and write the specific characteristic of the, disease ?, (4), , HSE-June-2012, 66. Following are the first two steps in, , Griffiths transformation experiment, , 62. Draw the flow chart showing the steps, , of southern blot hybridisation using, radiolabelled VNTR ?, (3), HSE-March 2013, 63. The flow of genetic information is, , shown below, , (2), , a)If there is any mistake correct it, b)write the remaining steps ?, , (1.5), , 67. DNA is the better genetic material than, , RNA, Do you agree with this, statement? Substantiate, (1.5), 68. Given below is the diagrammatic, representation of first stage of a, process in a bacteria, , a)Name the process a,b,c and d, 64. Given below is the figure showing the, , functioning of lac operon in presence, of lactose. Redraw the figure and label, the parts numbered 1 to 6, (3), , a)Identify the process, b)Name the enzyme catalyses this process, c)What are the additional complexities in, eukaryotes in this process ? (3), , NAVAS CHEEMADAN, , [email protected]

Page 27 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , HSE-March-2012, 69. A transcription unit is given below., Observe it and answer the question (3), , Click here to watch video lesson, , a)How can you identify the coding strand ?, b)Write the sequence of RNA formed from, this unit ?, c)what would happened if both strand of, DNA act as template for transcription ?, 70. In E.coli Lactose catabolism is, controlled by Lac Operon. Lac operon, in the absence of inducer (Lactose) is, given below., (3), , a)What is ‘P’?, b)Name the enzyme produced by the, structural gene ‘Z’,’Y’, and ‘A’ ?, c)Re draw the diagram in the presence of, an Inducer, , NAVAS CHEEMADAN, , [email protected]

Page 28 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, 7., , EVOLUTION, 1., , 2., , 3., , 4., , 5., , 6., , Identify the relationship and fill the, blank, (HSE August 2021)(1), a)Homologus organs : Divergent, evolution, ................................:, Convergent, evolution, The original seed eating finches in, Galapagos island evolved into many, other forms with altered beaks., Identify the evolutionary phenomenon, and define it, (HSE August 2021)(2), a) Define Hardy-Weinberg principle, b)Mention any four factors that affect, Hardy-Weinberg equilibrium, (HSE August 2021)(3), Select an example for homologous, organs., (HSE March 2021)(1), (a) Eyes of octopus and mammals, (b) Forelimbs of Whales and Bats, (c) Flippers of Penguins and Dolphins, (d) Wings of Birds and Butterflies, Evolution of Darwin finches is an, example for ‘Adaptive radiation’., (a) What is meant by ‘Adaptive, radiation’ ?, (b) Give two other example for, organisms those exhibit Adaptive, radiation. (HSE March 2021)(2), (a) Identify the equation related with, genetic equilibrium given below :, p2 + 2pq + q2 = 1, (b) Write the factors affecting genetic, equilibrium resulting in evolution., (HSE March 2021)(3), NAVAS CHEEMADAN, , 8., , Which among the following is an, example for homology ?(HSE JULY 2020)(1), (a) The eye of the Octopus and of, Mammals, (b) Sweet potato and potato, (c) Thorns and tendrils of Bougainvillea, and Cucurbita, (d) Wings of butterfly and of birds, Define Hardy – Weinberg principle., (b) List out any two factors affecting, Hardy – Weinberg Equilibrium., (HSE JULY 2020)(2), , 9., , Diagrammatic representation of the, operation of natural selection on, different traits is shown below :, (HSE JULY 2020)(2), , (i) Identify ‘a’, ‘b’ and ‘c’., (ii) What is the evolutionary significance of ‘b’ ?, , 10., , Which of the following human ancestor, is more ‘ape’ like? (HSE March 2020)(1), (a) Homo habilis, (b) Dryopithecus, (c) Australo pithecines, (d) Homo erectus, , [email protected]

Page 29 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , 11., , SOHSS-AREEKODE, , Fill the blanks in Column A and B using, appropriate terms. (HSE March 2020)(2), , 15., , Prepare a flow chart showing the, evolution of modern man in the, hierarchical order of their evolution, using the details given below :, Homo erectus, Homo habilis, Dryopithecus,, Australopithecines, Homo sapiens, Rama pithecus,, , (HSE-March-2019)(2), Some examples of evolutionary, structures are given below. Classify, them under suitable headings:, (a) Forelimb of Man, Cheetah, Whale,, Bat., (b) Wings of Butterfly, Bird., (c) Thorns and tendrils of Bougainvillea, and cucurbita., (d) Vertebrate hearts or brains., (e) Eye of the Octopus and Mammals., (f)Flippers of penguins and Dolphins., (HSE-March-2019)(2), Above homologous organs provide, evidence of a particular type of, evolution., (HSE-June 2018) (2), (a) identify the type of evolution., (b) What do you mean by Homologous, organs ?, Neander thal nman, , 16., , 12., , p2 + 2pq + q2 = 1 denotes an, evolutionary principle., (HSE March 2020)(2), , 13., , 14., , (a) Name the principle., (b) Mention any three factors affecting, this., Based on evolution in the geological, period arrange the plants and animals, in the correct order in various million, years ago. Choose the appropriate, organisms from the bracket., [Reptiles, Plants, Sea-weeds, Jawless, fish, Fish with stout fin], , 17., , (HSE-June-2019)(2), Make a flow chart using the following, terms :, (HSE-June-2019)(2), (Natural selection, Struggle for, existence, Variation, Origin of species,, 'Over production, Survival of the, fittest], NAVAS CHEEMADAN, , [email protected]

Page 30 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, 2, , SOHSS-AREEKODE, , 2, , 18. p +2pq+q =1 is the gene frequency of, the, population, showing, an, evolutionary principle, a)Name the principle, b)enlist any three factors affecting this, principle, (HSE-June 2018)(2), 19. Prepare a flow chart of evolution of, man in descending order by choosing, the names given below, (HSE-June 2018) (3), , 22., , 23., 20. Complete the boxes with the suitable, words given below, :, [Analogus, Homologus. Convergent, evolution. Divergent evolution], (HSE-March 2018)(2), , 21. Explain the factors affecting hardyWeinberg equilibrium, (HSE-March 2018)(2), Diagrammatic representation of Miller, experiment is given below. Answer the, following questions (HSE-Model 2018)(2), , NAVAS CHEEMADAN, , 24., , 25., , 1. Name A and B, 2.From those given below chose the, new molecules obtained by the other, scientists from similar experiment., (Amino acid, sugar, fat,, Alkaloid,, pigment , flavanoid ), A collection of moths made in England, during 1850, supported evolution by, natural selection', Write a note on the process of natural, selection on moths influenced by, industrialisation . (HSE-Model 2018)(2), Arrange the following names in, ascending order of evolution., Homo sapiens, Ramapitrecus,, Australopithecines,Homo habilis,, Neanderthal, Homo erectus, (HSE-Model 2018)(3), Rearrange the following in the order of, their evolution period, (HSE-JUNE-2017)(1), -Australopithecines, -Neanderthal man, -Homo sapiens, -Homo erectus, -Dryopithecus, Diagrammatic representation of the, operation of Natural selection on, different trait is given. Observe it and, answer the questions :, (HSE-JUNE-2017)(3), , [email protected]

Page 31 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , 28. Which of the following sets of gases, were used in Miller’s experiment?, (HSE-March-2017)(1), , a) What do B and C represent, b) Explain the process shown in B and C, 26. Z value of a frugivorous species are, given below . which value is not, applicable to continents, (HSE-March-2017)(1), (1) 0.6 (2) 0.65 (3) 0.20 (4)0.68, 27. A population of 208 people of MN, blood group was sampled and it was, found that 119 were MM group, 76MN, blood group, 13NN group. Answer the, following questions, (HSE-March-2017)(3), a) Determine the gene frequencies of, M and N alleles in the population, b) How does the above frequency, affect evolution?, Or, Examine the pictures of Darwin’s, finches given below and answer the, following questions, a)What phenomenon in evolution is, represented in the picture ?, b)explain the phenomenon with the, help of an additional example ?, , NAVAS CHEEMADAN, , 29. Observe the diagram and answer the, questions given below, (HSE-June-2016) (1), , a)Identify the type of evolution in the, concept diagram A and B ?, b)write example pair each for, homologous and analogous organs ?, 30. Statement below show features of, some human fossils. Read carefully and, identify the fossil (HSE-June 2016)(2), a)Human like being with brain capacity, 650-800cc, b)Lived in east and central asia with, brain capacity 1400 cc, 31. Which theory talks about huge, explosion that lead to origin of, universe ?, (HSE-March 2016)(1), 32. ‘Natural selction can lead to, stabilisation ,directional change and, disruptive change’, [email protected]

Page 32 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Explain, the, term, stabilization,, directional and disruptive change, mentioned above ?, (HSE-March 2016)(3), 33. Read the principle and answer the, question:, (HSE-March 2016)(3), “Allele frequency in a population are, stable and constant from generation, to, generation, called, genetic, equilibrium”, a)Name the principle mentioned here?, b)mention any two factors affecting, equilibrium ?, c)what is the significance of, disturbance occur in genetic, equilibrium ?, 34. Observe, the, diagrammatic, representation and answer the, question, (HSE-June 2015)(4), , a)Explain the phenomenon shown in, the figure ?, b)How can it consider as an evidence of, evolution?, c)Write any other example for this, phenomenon. Explain, 35. Four groups of organs are given below:, Read them carefully and answer the, questions, (HSE-June 2015)(4), NAVAS CHEEMADAN, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , a)Categorize the four groups of organs, as homologous and analogous organs ?, b)Based on each group of organs, differentiate convergent evolution and, divergent evolution ?, c)illustrate homologous and analogous, organ as evidences of evolution ?, 36. Match the following, (HSE-March-2015)(2), , 37. The above shown pictures are beaks of, a particular type of bird seen in an, island during Darwin’s journey, (HSE-March 2015)(2), a)identify the bird and name the, island?, b)write the significance of this process, in evolution ?, 38. Arrange the following in a hierarchical, manner in ascending order based on, their period of evolution., (HSE-June 2014)(1), , 39. a)The diagram given below shows a, particular type of evolutionary process, in Australian marsupials. Identify the, evolutionary, phenomenon and, comment on, [email protected]

Page 33 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , b)Give another example for such type, of evolutionary process and explain ?, (HSE-June 2014)(3), , 40. Given below is the diagrammatic, representation of operation of natural, selectionon different traits, a)Identify the type of natural selection, A,B, and C with explanation of each., b)Define Hardy-weinberg principle?, (HSE-March 2014)(4), , 41. A specific rat population was controlled, for about decade by a poison. After, population decline for about 10 years,, the rat population was increased and, stabilized., , NAVAS CHEEMADAN, , Resistance to poison is governed by a, dominant autosomal gene ‘R’. In 1975, majority of the resistant animals are, heterozygous at this locus (Rr), a)What was the major genotype of rat, population before 1961, A)RR, B)Rr C)rr, D)R is absent as it produced by a, mutation, b)What explanation you give for the, development of resistance against, poison in these rats ?, c) “This illustration can be used to, explain, theory, of, evolution”, Substantiate, (HSE May-2013)(2), 42. The diagram shows how the number of, species in different group of, vertebrates has changed between 400, million years ago and 5 million years, ago. The wider a block indicate the, more species there are, (HSE-May 2013)(3), , [email protected]

Page 34 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , 43., , •, •, •, •, , a)Which is the species found most at, 200 million years ago ?, b)Birds are most close relative to which, group of organism?, c)what is the trend observed in the, evolution of amphibians?, Arrange the following examples under, two heads viz-Homologous organ and, analogous organ (HSE-March 2013)(2), Fore limb of whale and bat, Wings of butterfly and bat, Heart of man and cheetah, Eye of octopus and mammal, , 44. Theory of chemical evolution is a, version of theory of abiogenesis., Analyze the statement., (HSE March -2013)(2), 45. Diagrammatic representation of the, operation of the natural selection in a, population is given (june-2012)(1), , Redraw the diagram when nature, select large sized and small sized, individuals, 46. Complete the flow chart showing the, evolution of man using age, name and, brain capacities of fossils, (June-2012)(3, ), NAVAS CHEEMADAN, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , 47. Note the relationship between the first, pair and complete second pair, (March-2012)(1), a)Natural selection : Darwin, Inheritance of acquired character, :......................., b)Heart of vertebrate : Homologous, organ, flipper of penguin and Dolphin, :.............., 48. A collection of peppered moths made, in England during different period is, given below, (March-2012)(1.5), , a)What is your observation ?, b)Name the evolutionary process, behind this process?, c)write the reason for decreased, number of white winged moth in 1920, ?, , [email protected]

Page 37 :
Join Telegram Channel: https://t.me/hsslive, , Navas cheemadan, , these biofertilisers enrich the soil, nutrients ? Give two examples, (HSE-June-2019)(2), 13.Microbes are useful to human beings in, diverse ways. If so, name the following, :, (HSE-March-2019)(2), (a) Microbe known as "Baker's Yeast"., (b) Lactic acid producing bacterium., (c)Fungus which helps in the production, of bio-active molecule – cyclosporine A., (d) Symbiotic nitrogen fixing bacterium., 14.In Sewage Treatment plant microbes, play a significant role. Distinguish, between primary and secondary, treatment, in, sewage, plant?, (HSE-June 2018)(2), 15.Complete the table with appropriate, terms, (HSE-March 2018)(2), , 16.Find the odd one out, a)Trichoderma polysporum, b)Clostidiumburyliorm, c)Acetobacteraceti, d)Aspergillusruger, (HSE-model 2018)(1), 17.a)Name the yeast used for the, commercial production of ethanol., b)Name the yeast used for the, production of statins, (HSE-model 2018)(2), 18.Complete the table by filling A,B,C and, D using hints from the bracket, (HSE-JUNE-2017)(2), NAVAS CHEEMADAN, , Downloaded from www.Hsslive.in ®, , SOHSS-AREEKODE, , (Gobar gas, biological control, anabaena,, Sacharomyces cerviciae , Prpionibacterium, sharmanii ), Methanogen- ........A............., Bread making-.........B............., Biofertilizer:.............C............, Trichoderma:...........D.........., 19.What are the advantages of, biofertilizers over chemical fertilizers?, Give an example for biofertilizer?, (HSE-March-2017)(2), 20.Chose the correct answer from the, bracket, (HSE-June-2016) (1), Cyclosporin A is produced by......., (a)Aspergillus (b)Clostridium, (c)Trichoderma (d)Acetobacter, 21.Select a bio-control agent from the, given microbe, (HSE-June-2016)(1), a)Baculo virus b)Rhino virus, c)Picorna virus d)Adeno virus, 22.“BOD is commonly calculated as an, index of water pollution”, a)Do you agree with this statement? Why?, b)Expand BOD?, (HSE-March 2016)(2), 23.In our state waste management is a, problem. Government promote and, give subsidy to biogas plants. Comment, the functioning of biogas plants with, the help of microbe., (HSE-June 2014)(2), 24.BOD of some water sample is given, below, (HSE-June 2015)(2), ASample-1 200mg/L, BSample-2 80mg/L, CSample-3, 300mg/L, DSample-4, 25mg/L, [email protected]

Page 39 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , 6, HUMAN HEALTH AND DISEASE, 1, , 2, , 3, , 4, , Innate immunity is characterised by, providing different types of barriers., Name the four types of barriers of, innate immunity (HSE August 20210(2), World Health Organisation has started, a number of programmes to prevent, the spreading of HIV Infection. Mention, any four preventive measures against, HIV infection, (HSE August 20210(2), Which is the causative organism for, malaria disease ? Name the two hosts, required for the malarial parasites to, complete its life cycle, (HSE August 20210(2), Observe the figure, (HSE March 2021)(2), , 7, , (a) Identify the bacterial disease among, , the enlisted., (b) Name its causative organism., (c) Mention any two symptoms of it., 8 Prepare a pamphlet as part of an, awareness programme in your school, regarding the “Prevention and control of, Alcohol and Drug abuse in adolescents”., [Hint : Prevention and control measures], (HSE-July-2020)(3), , 9, , 10, , 5, , Vaccines are given to children at, various stages of their development., (a) What is meant by ‘vaccine’ ?, (b) Write the principle of vaccination., (HSE March 2021)(2), Observe the list of certain common, diseases in human given below and, answer the following : (HSE-July-2020)(2), , Name any two protozoan diseases, its, causative organism and any two, symptoms., (HSE-March-2020)(2), Complete the illustration chart given, below., (HSE-March-2020)(2), , (a) Identify the molecular structure, given in the figure., (b) Name the regions labelled as A, B, and C., Drug/Alcohol, abuse, results, in, immediate and far reaching effects., Write some effects you have studied., (HSE March 2021)(2), , NAVAS CHEEMADAN, , [email protected]

Page 40 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , 11, , 12, , 13, , Explain the measures useful for, prevention and control of alcohol and, drugs abuse among adolescents., (HSE-March-2020)(3), 'Don't die of ignorance.', (a) About which it is mentioned ?, (b) List two measures taken by WHO to, prevent it, (HSE-June-2019)(2), Observe the figure and answer the, following questions (HSE-June-2019)(2), a) Identify the given molecule., b)Mention two types of immune, responses in human body., , SOHSS-AREEKODE, , (HSE-March-2019)(2), 16, , List of some diseases commonly, occurring in man are given below., Arrange them based on causative, organism in the table. Malaria,, Common cold, Typhoid, Ascariasis., Pneumonia, Ring worm, Amoebiasis, (HSE-March-2019)(2), Bacteria Fungus Virus Protozoan, , 17, , Identify the bacterial disease from the, following, (HSE-June 2018)(1), a)Typhoid b)Amoebiasis, c)Malaria d)Filariasis, Classify the following barriers of innate, immunity under 3 suitable heading, (HSE-June 2018)(3), , 18, , 14, , Write the effect of the following drugs, in human body, (HSE-June-2019)(3), (a) Ophiods (b) Cannabinoids, (c) Coca alkaloids, 15 Complete the flow chart given below, , NAVAS CHEEMADAN, , 19, , Innate immunity is a non-specific type, of defense and consists of four types of, barriers. Categorize the barriers and, give one example for each., (HSE-March 2018)(2), 20 Complete the table given below, (HSE-March 2018)(2), , [email protected]

Page 41 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , 21 Consumption of drug and alcohol affect, the person’s mental and physical, health very badly. List the warning sign, of alcohol or drug abuse, (HSE-March 2018)(2), 22 Study the relationship between the, first two words and fill the blank space, with a suitable word, Pnemonia : Streptococcus, pneumonae, Typhoid:.................., (HSE-Model 2018)(1), 23 Prepare a hand out to educate, students about the symptoms of the, dreaded disease cancer, its detection, and treatment, (HSE-Model 2018)(3), 24 Prepare a brief note to be presented in, an, awareness, programme, for, adolescents about AIDS, their causes, and preventive measures, (HSE-June-2017)(3), 25 Fill the box A,B,C and D, (HSE-JUNE-2017)(2), , SOHSS-AREEKODE, , a)....A............ – Cancer, b) Allergy, , -..B........., , C).....C.......-AIDS, d)Rheumatoid arthritis-.......D......, 27 Morphine is said to be an abused drug., Discriminate the term ‘use’ and ‘abuse’, of the drugs based on this example ?, (HSE-March-2017)(2), 28 Differentiate active immunity from, passive immunity. Give an example for, passive immunity ?, (HSE-March-2017)(2), 29 Complete the table by filling a,b,c and d, (HSE-June 2016)(2), , 30 Answer the question about the given, figure, (HSE-June 2016)(2), , 26 Fill the blanks A,B,C and D using correct, terms given in the box, (HSE-JUNE-2017)(2), Passive immunity, Sensitivity to some particles, Metastasis, Active immunity, Autoimmune deficiency, Immune deficiency disease, NAVAS CHEEMADAN, , a)Identify the part X and Y ?, b)Name any two type of this, molecules ?, [email protected]

Page 42 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , 31 Select odd one out and justify your, selection, (HSE-June 2016)(1), Malaria, Gonorrhoea, Amoebiasis,, filariasis., 32 Identify the disease shown in the, following figure and write the, causative organism of the disease, (HSE-March 2016)(1), , SOHSS-AREEKODE, , 36, , 37, 38, , 33, , “Blood of a man is tested positive for, cannainoid”, a)what are these?, b)from where there are extracted, naturally ?, c)which part of the body is affected, by these ?, (HSE-March 2016)(3), 34 Match the terms given in three, coloumn of table correctly, (HSE-June 2015)(2), , 39, , (HSE-March-2014)(2), Typhoid,, Malaria, Pneumonia, Diphtheria, Amoebiasis, , 40, , 41, 35 “If proper care and attention is not, given by adults, adolescent may, become addicted to drug or alcohol”., NAVAS CHEEMADAN, , What is your opinion about this, statement ? substantiate your answer ?, (HSE-June 2015)(2), Cancer is one of the most dreaded, diseases of human beings, and is major, cause of death all over the globe, (HSE-March-2015)(3), a)what are the causes of cancer?, b)what are the methods for, detection of cancer?, c) What are the types of treatment, of cancer?, Briefly describe the characteristic of, cancer cells ?, (HSE-June 2014)(2), It is said that “Chikunguniea” once, affected will not a person in next half, of his life. Justify this statement, (HSE-June 2014)(2), Classify the diseases given in the box, as two groups based on their, causative organism. Specify the type, of causative organism for each group, , Prepare a pamphlet for an awareness, programme in your school about the, measures to prevent and control, alcohol and drug abuse in adolescents, (March-2014)(2), The meaning of ‘antibiotics’ is, ‘against life’, where as with reference, to human being is is ‘pro life’, (March-2014)(2), [email protected]

Page 43 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , 42, , 43, , 44, , Substantiate this statement with, suitable example ?, Prepare a pamphlet for adolescent, children to make them aware of, alcohol and drug abuse?, (HSE-May 2013)(2), “Prevention is better than cure” . This, statement is true in the case of AIDS, as, well, as, immunisation, ., Substantiate (HSE-May 2013)(2), Most often HIV Infection occur due to, conscious behaviour patterns. Do you, agree with this statement ?, Substantiate your answer?, , (HSE-March 2013)(2), 45 Nature has as many verities of plants, which give drugs for abuse, as there, are medicinal plants which give, medicines. Substantiate with two, examples, (HSE March, 2013)(2), 46 Note the relationship between first two, terms and suggest a suitable term for, the fourth place, (june-2012(1), a)Erythroxylum coca : Cocaine, Papaversomniferum :..............., b)salmonella typhi : Typhoid fever, plasmodium falciparum :............, 47 One of your Friend Argued that antiretroviral, drugs, are, effective, medicine, to, treat, AIDS, (June-2012)(3), a)What is your opinion about it?, b)How HIV affect our immunity ?, , NAVAS CHEEMADAN, , SOHSS-AREEKODE, , 48, , Arrange the following diseases in the, following coloumn in correct order, (March-2012) (2), Typhoid,Ring worm, Amoebiasis,, AIDS, Malaria, Pneumonia, Common, Cold, , 49, , In a class room discussion a student, argues that allergic reaction are more, common in metro cities than in, villages., (March2012)(2), a)Do you agree with this statement ?, b) Which type of immunoglobulin is, responsible for allergic reactions?, c) suggest two drugs which reduce, allergic symptoms ?, , Click here to watch video lesson, , [email protected]

Page 44 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , SOHSS-AREEKODE, , 8., BIODIVERSITY AND CONSERVATION, , 1. Biodiversity can e descried at 3 levels of, biological organizations, a) Mention three levels of biological, diversity ?, b)Who, popularized, the, term, “Biodiversity”, (HSE-August) (2), , 2., , Mention the two conservative approaches, to protect our biodiversity. Give one, example for each conservative approach ?, (HSE-August) (2), , 3., , Now-a-days, the world is facing a problem, of increased rate of species extinction due, to human activities’. Write major causes, of biodiversity losses, (HSE March, 2021)(2), , 4., , “Species diversity is greater in tropical, regions than in temperate regions.” Give, reasons. (HSE March 2021)(2), , 5., , (a) The term ‘biodiversity’ was, popularised by _________., (b) Name the two types of biodiversity, conservation., (c) Write any three causes of biodiversity, , (HSE-July 2020)(3), Select the cause of extinction of, Cichlid fish in lake Victoria of East, Africa. (HSE-March 2020)(1), (a) Habitat loss and fragmentation, (b) Over-exploitation, (c) Alien species invasions, (d) Co-extinctions, Tropical Amazonian rainforest in, South America has the greatest, biodiversity on earth. Do you agree, with this? Explain., (HSE-March 2020)(2), loss., , 6., , 7., , NAVAS CHEEMADAN, , 9., , 10., , 11., , 12., , In your school the Science Club, decided to conduct a seminar about, "Biodiversity, conservation, Approaches". You are invited, to.present a paper on this seminar., List out the main points you, included in the presentation., (Hint : In Situ, Ex-Situ conservation), (HSE-June-2019)(3), Which among the following belongs, to ex-situ conservation?, Wildlife sanctuaries, Bio sphere, reserves, Zoological parks, National, parks, Sacred groves, (HSE-March-2019)(1), The causes of biodiversity loss are, designated as "EVIL QUARTET"., Explain the Evil Quartet in, biodiversity loss., (HSE-March-2019)(2), Human beings can conserve and, protect ecosystem and biodiversity., Prepare a handout to show, different methods of biodiversity, conservation? (HSE-June 2018)(2), Observe the graph and answer the, following questions, (HSE-March 2018)(3), , [email protected]

Page 45 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , a) Name S,A,C and Z in the graph, b) Name the scientist who explained, species-area relationship, 13. "The accelerated rates of species, extinction that the world is facing, today is largely due to human, activities"., (HSE-Model 2018)(3), Do you agree with this statement., Justify your answer., 14. Explain the levels of biodiversity?, (HSE-JUNE-2017)(3), 15. Explain, different, types, of, biodiversity, conservation, with, example, (HSE-JUNE-2017)(3), 16. Distinguish, between, in, situ, conservation, from, ex, situ, conservation with one example, each ?, (HSE-March-2017)(2), 17. “When we conserve and protect, the, whole, ecosystem,, its, biodiversity at all levels is, protected”. Based on this statement, explain the strategies of biodiversity, conservation, (HSE-June 2016)(3), 18. “when need turns to greed, it leads, to biodiversity loss”. Substantiate, this statement by explaining two, causes of biodiversity loss., (HSE-June 2016)(3), 19. Observe the concept diagram of Evil, Quartet of biodiversity loss, (HSE-March 2016)(2), , NAVAS CHEEMADAN, , SOHSS-AREEKODE, , a)Write A and B, b)What is co-extinction ?, 20., , Read the statement and chose the, correct option (HSE-March 2014)(1), , 21., , Two, approaches, for, the, conservation of biodiversity is, shown as A and B(HSE-June 2015)(3), , a)Identify the type of conservation, shown in A and B?, b)Write the difference between two, types of biodiversity conservation, shown in A and B?, [email protected]

Page 46 :
Join Telegram Channel: https://t.me/hsslive, , Downloaded from www.Hsslive.in ®, , Navas cheemadan, , 22., , 23., , 24., , 25., , c)Which of the above approach is, more desirable when there is an, urgent need to save species ?, We have moral responsibility to, take good care of earth’s, biodiversity and pass it on in good, order to next generation., a)Define biodiversity?, b)write causes for biodiversity loss?, c)Name two type of biodiversity, conservation ?(HSE-March 2015)(3), a)Variety of species are present, around us, what they constitute and, comment?, b)comment on in situ conservation, and ex situ conservation?, c)In these aspect explain the, concept of hot spot with examplegive importance to recent issues, with regard to western ghat, (HSE-June 2014)(3), “Nature provides all for the need of, man but not for his greed”, a)Do you agree with this statement?, Justify your answer, b)distinguish between two types of, biodiversity conservation ?, (HSE-March 2014)(3), While preparing the species are, relationship graph of 4 areas, the, following Z values are obtained, Area A =0.1, Area B= 0.8, Area C =1.2, Area D= 0.3, a)Which area show maximum, species richness ?, , NAVAS CHEEMADAN, , SOHSS-AREEKODE, , 26., , 27., , 28., , 29., , b)what are the expected reasons for, the loss of biodiversity in area with, low species richness ?, (HSE-May 2013)(3), “Nature does lot of service for, which an economic value or price, tag cane put” substantiates giving, examples., (HSE-March 2013)(2), “Conservation of biodiversity is a, collective responsibility of all, nations”. Write a slogan stressing, the significance of biodiversity, conservation? (HSE-March 2013)(1), Last twenty years alone have, witnessed the disappearance of 27, animal species from earth., (June2012)(3), a)Name the animal disappeared, recently, b) What may be the causes of this, loss ?, c) How can we conserve, biodiversity?, The given graph shows the, distribution of insects in different, latitude of earth (March-2012)(3), , a)What, is, your, observation, ?, b)List the three reasons for greater, biodiversity in tropical region ?, [email protected]